Your English writing platform
Discover LudwigSuggestions(1)
Exact(49)
The amir has presence.
The Amir answered by saying that Hamas needs Iranian support.
The Amir agreed that "demographics are a big worry".
(C) Your instinct is right, replied the Amir.
"The Amir [Al Baghdadi] takes what the Amir wants," the fighters said, and demanded that he hand over his keys to the department.
The Amir arrived one day at a small mosque, downtown, surrounded by rosebushes.
Similar(11)
To select the amiR-53R that has the best inhibition efficiency, the amiR-53Rs were initially tested for sequence-specific silencing on the target 53R gene by employing transient transfection of a plasmid expressing 53R (pEGFP-N3-53R).
This is an indication of plasmolysis, implying the abnormal cellular osmotic homeostasis inside the amiR-atpv42b-1 pollen grains.
The amiR-CESA4 construct targets AAGGGACCCATTCTTAAGCCA with hybridization energy of −37.74 kcal/mol and the amiR-CESA7 construct targets ACGCCCACCATTGTCATCATC with hybridization energy of −37.37 kcal/mol.
To test if the Medicago FTa1 gene was likely to be targeted by the amiR-FT, it was aligned with the amiR-FT sequence.
Thus, FTa1 functions to promote flowering in Arabidopsis, but does not appear to be targeted by the amiR-FT.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com