Sentence examples similar to that spans back from inspiring English sources

A forward primer that spans Exon3 and Exon4, (5′GGAGACAGGTTGCGAGTTCTATGCCTTC3′) and a reverse primer that spans Exon6 and Exon7 (5′GATGTGCGAGTATCCAGC AAAGGCCAC3′) were used to amplify OPN4 transcripts.

They share a timeline that spans 30 years.

One is for detecting pedestrian crosswalks in a region that spans 180,000 sq.

In a racing season that spans 10 months, Team Columbia, my squad, will compete on 268 days throughout the world.

In a career that spans 50 years and counting, as Sendak's does, there are bound to be lesser works.

It's a mainstream crime novel that spans 50 years and aspires to mix mystery with history.

We applied these predictors to the TCGA PanCanAtlas dataset that spans ~10,000 patients across 33 different tumor types.

km, and the other is for detecting power transmission-line towers in a region that spans 150,000 sq.

The game will be McDermott's first visit to St James Parkk during a career that spans 36 years.

(212-399-3030) www.MAnewttanTheatreClub.org "EVERETT BEEKIN" A new play by Richard Greenberg ("Three Days of Rain") that spans 50 years and four generations of a Jewish immigrant family.

It is the high point of a rarely-told story that spans 50 million years.