Sentence examples similar to that spans back from inspiring English sources

The phrase 'that spans back' is correct and usable in written English
You can use it to refer to something that happened or existed in the past. For example: "The political alliance that spans back to the Cold War era has been weakened recently."

Similar(59)

A forward primer that spans Exon3 and Exon4, (5′GGAGACAGGTTGCGAGTTCTATGCCTTC3′) and a reverse primer that spans Exon6 and Exon7 (5′GATGTGCGAGTATCCAGC AAAGGCCAC3′) were used to amplify OPN4 transcripts.

They share a timeline that spans 30 years.

One is for detecting pedestrian crosswalks in a region that spans 180,000 sq.

In a racing season that spans 10 months, Team Columbia, my squad, will compete on 268 days throughout the world.

In a career that spans 50 years and counting, as Sendak's does, there are bound to be lesser works.

It's a mainstream crime novel that spans 50 years and aspires to mix mystery with history.

We applied these predictors to the TCGA PanCanAtlas dataset that spans ~10,000 patients across 33 different tumor types.

km, and the other is for detecting power transmission-line towers in a region that spans 150,000 sq.

The game will be McDermott's first visit to St James Parkk during a career that spans 36 years.

(212-399-3030) www.MAnewttanTheatreClub.org "EVERETT BEEKIN" A new play by Richard Greenberg ("Three Days of Rain") that spans 50 years and four generations of a Jewish immigrant family.

It is the high point of a rarely-told story that spans 50 million years.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: