Sentence examples for that spans from inspiring English sources

His is the seventh untimely death in an index of lamentation that spans four generations.

It is a relationship that spans two decades.

Islam is a religion that spans the globe.

It's an environment that spans all social networks.

Or maybe Burial reinterpreting Beethoven, something that spans the generations.

They share a timeline that spans 30 years.

The other is a nation that spans the planet.

It is an effort that spans the whole academic year.

A forward primer that spans Exon3 and Exon4, (5′GGAGACAGGTTGCGAGTTCTATGCCTTC3′) and a reverse primer that spans Exon6 and Exon7 (5′GATGTGCGAGTATCCAGC AAAGGCCAC3′) were used to amplify OPN4 transcripts.

Community currency has a history that spans Victorian and Depression-era desperation.

"There's the same passion in discussion, but there's an ethic that spans the conversation.