that span across

USAGE SUMMARY

"that span across" is correct and usable in written English.
It is most commonly used when referring to a period of time that includes multiple dates, or to a distance that stretches across multiple areas. For example: The factory closure will affect employees that span across 3 states.

✓ Grammatically correct

Science

News & Media

Formal & Business

Human-verified similar examples from authoritative sources

Similar Expressions

60 human-written examples

The adiponectin gene is located on human chromosome 3q27, where a region identified as a susceptibility locus for metabolic syndrome and T2DM has been reported, and is composed of three exons that span 17 kb[45], [46], [47], [47].

Plosone

The SNPRN-UBE3A locus, which encompasses the SNORD115 and SNORD116 gene families, is a complex non-coding RNA region that spans 15q11-q13 [ 32].

BMC Medical Genomics

Prostheses are then classified by the number of years post-implantation that the evidence spans (3, 5, 7, or 10) and by the quality of the data supplied (level A being strong evidence, level B reasonable evidence, and level C weak evidence); 10A is the highest rating available.

British Medical Journal

In the 4 years that span 2006/2007 and 2009/2010 there were a total of 19 seizures of methadone by UK customs.

BMJ Open

The N-terminal helices of hRio2NES-R and CPEB4NES-R that span Φ0 Φ3 bind CRM1 much like the helix of the plus direction PKINES.

eLife

In addition to the single rDNA locus that includes 25 to 175 tandem repeats, C. albicans chromosomes each carry one or two major repeat sequences composed of nested repeat units that span 50 to 130 kbp [ 9, 10].

Genome Medicine

In this analysis, we excluded 3 HDIs that span centromeres on chromosomes 12, 16, and 18 as the size of these regions is likely overestimated due to the absence of typed SNPs and the very low recombination rate in these regions.

BMC Genomics

All vertebrate Dkks contain both the Dkk_N and colipase fold domains, separated by a non-conserved linker region that spans 50 55 aa in Dkk1, Dkk2 and Dkk4, but only 12 aa in Dkk3.

Nature

A forward primer that spans Exon3 and Exon4, (5′GGAGACAGGTTGCGAGTTCTATGCCTTC3′) and a reverse primer that spans Exon6 and Exon7 (5′GATGTGCGAGTATCCAGC AAAGGCCAC3′) were used to amplify OPN4 transcripts.

Nature

In the second one, from now on referred to as perturbed run, the colour of a small region of the east Sahara, that spans 3 × 3 pixels (longitude: 10°-20°, latitude: 18°-26°), is darkened from beige (bright sand) to very dark green (the colour of the darkest forests).

Geoscience Letters

One tandem array that spans ~143 kb (Chr5: 17,543,001 - 17,686,000 of hg18) was identified on the short arm of human chromosome 5 at 5p15.1.

BMC Genomics

Expert writing Tips

Best practice

When using "that span across", ensure it clearly indicates a range, duration, or extent. Check if a more precise verb like "extend", "cover", or "range" might be more appropriate for your specific context.

Common error

Avoid using "that span across" when a simpler, more direct verb like "cover" or "include" would suffice. Overusing "span across" can make your writing sound unnecessarily verbose.

Linguistic Context

The phrase "that span across" functions as a relative clause, modifying a noun by describing its extent or range. Because Ludwig has no examples, the function cannot be determined precisely via data analysis but based on general grammar knowledge.

Expression frequency: Missing

Frequent in

Science

0%

News & Media

0%

Formal & Business

0%

Less common in

Science

0%

News & Media

0%

Formal & Business

0%

Ludwig's WRAP-UP

In summary, "that span across" functions as a relative clause used to describe something covering a range or duration. Ludwig indicates that the phrase is grammatically correct, although no real-world examples were found. When using "that span across", consider if a more precise alternative like "that extend over" or "which cover" might be more effective, and avoid overuse to maintain clarity and conciseness in your writing. While seemingly grammatically sound, the absence of examples suggests its limited usage, making careful consideration essential before incorporating it into your writing.

More alternative expressions

Phrases that express similar concepts, ordered by semantic similarity:

that stretch across

Emphasizes the physical extension or length using 'stretch'.

that extend over

Focuses on spatial extension, using 'extend' instead of 'span'.

which reach across

Similar to stretch across, but uses reach instead of stretch

which cover

Uses 'cover' to imply the inclusion of multiple elements within a range.

that encompass

Focuses on the inclusion of items within a defined boundary.

that range from

Highlights a range between two points, rather than a continuous span.

that traverse

Implies movement or passage across an area.

that include

Highlights specific inclusions rather than a continuous range.

that bridge

Suggests connecting two separate points or ideas.

that overlay

Focuses on a layering or covering of one thing on another.

FAQs

How can I rephrase "that span across" for variety?

Consider using alternatives like "that extend over", "which cover", or "that range from" to add nuance and avoid repetition.

What does "that span across" imply about the subject?

It suggests the subject covers a range or duration, encompassing multiple points or areas. Understanding this implication helps ensure accurate and effective use.

Is "that span across" always the best choice for indicating a range?

Not necessarily. Depending on the context, more precise verbs like "that include", "that traverse", or "that reach across" might offer greater clarity.

How can I ensure I'm using "that span across" correctly?

Check if the context clearly indicates a continuous range or duration. If the emphasis is on individual elements, consider using alternatives like "that encompass" or "that include".