Your English writing platform
Discover LudwigSuggestions(1)
Exact(19)
These compounds were separated into two classes: those that bind within the catalytic site (and being inhibitors) and those that bind outside it (and therefore not being inhibitors).
Such positions were not found for class B GPCRs, in agreement with the observation that there are not known ligands that bind within their TM helical bundle.
We defined the enrichment of over under -expressed genes that bind within a distance d as
In the present work, we describe the isolation and characterization of two novel transcription factors that bind within the 38-bp -1103- ACATTTCTCGTAAATACGTACAATATCCTTGTCTTTCC -1061- of the SWRE region of the sporamin promoter of the sweet potato.
We selected bohemine [32], roscovitine [33], and butyrolactone [24], which are purine analogs that bind within the ATP binding pocket.
We could, however, identify the epitopes of all antibodies that bind within the first 100 amino acids of PrP by peptide competition ELISA.
Similar(41)
We demonstrate that Takinib is an inhibitor of autophosphorylated and non-phosphorylated TAK1 that binds within the ATP-binding pocket and inhibits by slowing down the rate-limiting step of TAK1 activation.
Consistent with this observation, blocking aggregate-formation using an intrabody (scFv-C4) that binds within the first 17 amino acid residues of huntingtin potently suppressed httex1-mediated toxicity, analogous to its protective role in other HD models [19], [43], [64].
First, we estimated the complexity of transcriptional regulation for each gene, by counting the number of TFs that bound within 10 kb upstream of the TSS in the human cell line GM12878.
Hamster polyomavirus (HaPyV) VP1 protein has been exploited for the generation of either chimeric VLPs harbouring foreign epitopes, or pseudotype VLPs when co-expressed with the minor capsid protein VP2 that binds within the central 5-fold cavity of each VP1 pentamer [ 8– 11].
Pattern recognition receptors (PRRs), e.g. toll receptors (TLRs) that bind ligands within the microbiome have been implicated in the pathogenesis of cancer.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com