Sentence examples for tested by insertion from inspiring English sources

The utility of the selection markers was tested by insertion of the resulting mini-Tn7 elements into the genomes of Burkholderia thailandensis and B. pseudomallei efflux pump mutants susceptible to aminoglycosides, aminocyclitols, and streptothricins, followed by Cre-mediated antibiotic resistance marker excision.

Finally, the mechanical stability of the prepared implants was tested by their insertion into bovine trabecular bone cores ex vivo followed by retrieval, which confirmed the robustness of the TNT structures.

The presence of the insertion was tested by PCR using the three primers, Ape2 forward ("Ape1") 5'TTGATCATATCTTAGTTGCTGG3'; Ape2 reverse ("Ape3") 5'GandCATTCGGTTCTGTGATGC3'; and JL202 5'CATTTTATAATAACGCTGCGGACATCTAC3'.

The presence of the insertion was tested by PCR using a combination of three primers: Ape1L forward ("HAP7"): 5'CCCTGCCTTTCGCCGGAAAAGCGT3'; Ape1L reverse ("HAP6"): 5'TAACCTCAATCAAATCTTCAATGCATCTC3'; T-DNA left border ("TAG5"): 5'CTAG5AATAG5CTAG5CTAG5CGAC3'.

The positive plants were selfed and the homozygosity status of the insertion allele was tested by screening its segregation in the progeny.

Comparisons between different insertions conditions were tested by ANOVA and results are presented with the associated P value for significant data.

This was tested by PCR using gene‐specific primers against the flanking region of the second insertion but no insertion could be detected (Author response image 1D).

The transformed plants were selected on solid medium with 30 μg of Hygromycin B and tested by PCR with the primer described above for the insertion of ScFKBP12.

Correct insertion of the knock-in allele was tested by probing the 5' and 3' ends of cryab in the plasmid construct, and using primers outside cryab.

Genomic DNA prepared from these lines was tested by PCR and DNA sequencing to confirm the presence of a single-copy insertion in the Mos-1 ttTi5605 Mos-1 ttTi5605te on chromosome insertion

The suitability of AG as an expression vector in plants was tested by analysis of two infectious viral constructs, each containing a distinct gene insertion site.