Your English writing platform
Discover LudwigExact(4)
A graph of a network consists of nodes (which correspond to TFs, transcription factors and TTs, terminal targets) and directed edges/interactions.
In our random networks we kept all original connections from TFs to Terminal Targets (i.e. regulated genes which are not TFs themselves. Later we refer to them with abbreviation TTs).
In Table 5 we use PERCENTPATH to denote the percentage of the shortest paths from transcription factors to the terminal targets that either originate or go through LSCC, and PERCENTLENGTH to denote the similar percentage for the sum of lengths of shortest paths.
In spite of their modest number (they involve 25 of 142 transcription factors that were included in the data set), the transcription factors that are included in cycles have a large topological impact: most of the shortest paths between transcription factors and terminal targets go through them.
Similar(56)
One hour later, almost all the Golgi complexes were filled with QDs, providing evidence that the Golgi complex is also an important terminal target of these thiol-capped CdTe QDs.
My partner, Matt, had just flown out of Istanbul Ataturk Airport's international terminal, the same terminal targeted by attackers.
TT, terminal target.
The 5′ terminal targeting fragment was amplified using AAGGGATCCAATACCTTGAAATTAATAATCCATC and TTAACTGCAGCTGATGCTGTC, and the 3′ terminal fragment was amplified using CTGATATTGCCTCATTCCATGGCTTCG and TTGGTGATTGTGGGGTACCAGTAC.
As previously reported (14), the nerve terminal targeting of hSynI was not affected by the Q555X mutation.
Mammalian P32 is targeted to mitochondria by an amino terminal targeting sequence that is cleaved to generate a mature P32 protein localized within the mitochondrial matrix.
No N- terminal targeting signals were identified in the four other Paulinella proteins, Hli, CsoS4A, and homologs to Synechococcus WH5701_ 06721 and WH5701_ 13905[ 157].
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com