Sentence examples for terminal target from inspiring English sources
"terminal target" is a correct and usable phrase in written English
You can use it when you want to describe a final or ultimate goal or objective that someone is trying to reach. For example, "Their terminal target was to reduce the overall cost of production by 25%."
One hour later, almost all the Golgi complexes were filled with QDs, providing evidence that the Golgi complex is also an important terminal target of these thiol-capped CdTe QDs.
The orphan RR protein CtrA (shown in blue in Fig. 4A) scores negatively with all kinases, consistent with a previous report that it is the terminal target of a phosphorelay and gets phosphorylated by an Hpt domain phosphotransferase rather than by any of the orphan SK proteins [28].
Ideally, Aumann's proofs that "like-minded" decision makers "cannot agree to disagree," provided they have the same information knowledge (encoded by priors and likelihoods), should be the practical terminal target of the trajectories shown in Figure 1.
Rostral extending axonal bundles were seen to defasciculate and ramify within their terminal target fields, providing widespread innervation of specific host structures throughout the forebrain, extending more than 10 mm from the graft core.
Osawa and Matsumoto proposed that protein phosphorylation was associated with the Al-activated malate secretion from wheat root apex and that the OA anion-specific channel was possibly a terminal target that responded to Al signal mediated by phosphorylation [ 79].
My partner, Matt, had just flown out of Istanbul Ataturk Airport's international terminal, the same terminal targeted by attackers.
32 The relationship among sarilumab dose regimens, sarilumab trough levels, and changes in CRP in MOBILITY Part A is consistent with data reported in a Phase I study in patients with RA. 30 Those results show that sarilumab PK is characterised as non-linear, consistent with an initial absorption phase, followed by a saturating β phase and a subsequent terminal target-mediated elimination phase.
The 5′ terminal targeting fragment was amplified using AAGGGATCCAATACCTTGAAATTAATAATCCATC and TTAACTGCAGCTGATGCTGTC, and the 3′ terminal fragment was amplified using CTGATATTGCCTCATTCCATGGCTTCG and TTGGTGATTGTGGGGTACCAGTAC.
As previously reported (14), the nerve terminal targeting of hSynI was not affected by the Q555X mutation.
Mammalian P32 is targeted to mitochondria by an amino terminal targeting sequence that is cleaved to generate a mature P32 protein localized within the mitochondrial matrix.
