Sentence examples for templates were then from inspiring English sources

Wood templates were then prepared from the scrive board and steel plates marked off and cut to size.

The AAO templates were then removed by immersion in 1 M NaOH solution overnight.

Templates were then PCR screened to identify individual clones containing the gene of interest.

These two sets of templates were then, in a semi-automatic way, matched to the recorded force (taking into account the instantaneous muscle length to interpolate across noise templates), and the two sources of noise were then subtracted off sequentially.

The cDNA templates were then used in PCR amplification in 20 or 24 cycles of PIN2 and Actin (AT5G09810) transcripts with the following gene-specific primers: (PIN2-f) 5' CCGTGGGGCTAAGCTTCTCATCT 3'; (PIN2-r) 5' AGCTTTCCGTCGTCTCCTATCTCC 3'; (Actin-f) 5' CAGTGTCTGGATCGGAGGAT 3' and (Actin-r) 5' TGAACAATCGATGGACCTGA 3'.

Templates were then pin-replicated from the lysis plate.

The templates are then converted into solid microcapsules with a matrix structure by solvent evaporation.

These templates are then validated using information from the History Database and Constraints Validator.

Both cancelable templates are then merged together using concatenation-based feature level fusion technique [20] to generate a combined template.

These templates are then used in demodulation, resulting in a low-complexity non-coherent alternative to complex Rake receivers.

These templates are then arranged in order, given the right twist angles, glued and screwed to form a whole blade template.