Sentence examples for templates the two from inspiring English sources

Exact(2)

After removing the templates, the two kinds of synthesized PIPs were used to adsorb natural BiP or FKBP23 from ER extract; both showed high selectivity.

With respect to the serially diluted synthetic templates, the two most diluted calibration spikes (cYIR09 and cYIR10) in the samples with 1000 cells were below the threshold, while for 250 cell samples, the five most diluted calibration spikes cYIR06-cYIR100) were below threshold.

Similar(58)

When there is no template, the two probes combine to form a complex probe and therefore no fluorescence is produced; when there are templates, the fluorescent probe hybridizes with the templates first, and the fluorescence is not quenched.

Using the genomic DNA of E. coli DH5α as template, the two genes encoding Fld and FdR were amplified with the primer pairs of Fld-BamHI-F/Fld-SalI-R and FdR-BamHI-F/FdR-SalI-R, respectively.

To circumvent the difficulties we encountered in obtaining high quality crystals, we resorted to homology modeling of TaOMT2 using Medicago sativa MsCOMT [ 16] as a template; the two proteins share 63% sequence identity.

Structural templates for the two LGI1 domains were found using MANIFOLD [32] and MetaServer [33].

The cDNA templates of the two samples were normalized with beta-actin.

A similar procedure was used to equate activity rates for cued and uncued templates during the two rest periods.

By using the recombinant plasmid pET-28a-Tspox as template, the four mutant plasmids bearing K312E, E539K, T166A/E539K and K312E/E539K substitutions were obtained.

Three orthopaedic surgeons (AJC, SL and JCB) independently templated the five tibiae with both trays on two separate occasions.

This intron was PCR amplified using pIGI121Hm [ 41] as template and the two adapter/primer sequences: 5' CGACGGACCGATCTAGAACATGGATCCCTACAGGGTA and 5' TCAGCTGCAGACTAGTTACAGGACGGACGAGTCGACGGTTC.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: