Taking these short fragments as templates, the first-strand cDNA was synthesized using random hexamer-primer and reverse transcriptase.
Using these short fragments as templates, the first-strand cDNA was synthesized with random hexamer-primer (TaqMan Gene Expression Assays).
Taking these fragments as templates, the first-strand cDNA was synthesized using random hexamer primers and Super-script TM III (Invitrogen TM, Carlsbad, CA, USA).
Taking these short fragments as templates, the first-strand cDNA was synthesized using random hexamer primers and Superscript TM III (Invitrogen™, Carlsbad, CA, USA).
Using these shorter fragments as templates, the first-strand cDNAs were synthesized using Roche random primers and the AMV reverse transcriptase from the cDNA Synthesis system and the GS Rapid Library kits (Roche Applied Science, Mannheim, Germany).
We used as templates the second-round amplified cDNAs of wild type muscles and pros mutant muscles, prepared as described for microarray analyses.
In this study, we engineered a highly efficient, soft, hydrophilic CuO chitosan (CS) NF template, the first of its kind.
By using this anchor-cDNA as the template, the first and the nested PCRs were carried out with 2 sets of primers, anchor-1/ORF1-R14 anchor-2/ORF1-R13 anchor-2/ORF1-R13 anchor-2/ORF1-R13
Two overlapping fragments were amplified using pCI-Trim17 as template, the first with primers 5′ CGAGAATTCTGAGCCATGGATGC 3′ and 5′ CAATGTACTGTTTGGAAGTAGGGACAGCTGTTTTTTCC 3′, the second with primers 5′ CTACTTCCAAACAGTACATTGGTCACTCTCACAGAGCC 3′ and 5′ GACTCTAGACTATCCCTTCACCCACATGG3 ′.
Thus, when users would like to replicate existing environments, they need to describe templates from the first.
Using these first round PCR products as template, the second round PCR was performed to separately amplify exons 6 and 8.
