Your English writing platform
Discover LudwigSuggestions(2)
Exact(1)
Total RNA (1 µg) was reverse transcribed using the SuperScript One-Step RT PCR for Long Templates system and amplified using high fidelity Pfx DNA polymerase essentially as described by the manufacturer (Invitrogen).
Similar(59)
One of my most illuminating questions is: "What's your strategy for keeping up-to-date with the Cambrian explosion of technical frameworks, languages, databases, templating systems, and so forth?" Everyone has a strategy — but nobody seems to feel that theirs is particularly good.
Given these templates, we defined the likelihood that a wavelet was drawn from one of these templates, T, by transforming it into the appropriate template coordinate system and calculating p xi|T) for each coordinate value, xi.
This is in agreement with the observation in [10] that the template matching system and the HMM system behave differently in word error patterns.
The libraries were pooled at equimolar concentrations and clonally amplified and enriched onto Ion Spheres using the Ion One Touch™ Template Prep System and the Ion Torrent One Touch™ PGM 200 Kit Life Technologies Itemm # 4478316).
Primers vanB-L1: 5'-GTTTGATGCAGAGGCAGACGACT and vanB-L2 5'- ACAAGTTCCCCTGTATCCAAGTGG were used to amplify a 5,959 bp product using the Expand Long Template PCR system and conditions set by the manufacturer (Roche Applied Science, Mannheim, Germany).
The chin template system included a cutting guide and a repositioning guide for a two-piece narrowing genioplasty.
Two weeks before surgery, all implants were selected according to the preoperative plan using a 3D templating system (ZedHip, Lexi Co., Tokyo, Japan), and iodine-containing surface treatments were applied by the Chiba Institute of Technology (Narashino, Japan) using the technique described by Hashimoto et al. [ 13].
The primary intention of the template system is to improve time, efficiency, and billing accuracy[ 8].
The system has been built from the ground up to be extended infinitely and is wrapped in a template system that will be open to CSS designers.
A second important aspect of the template system is that it is a highly flexible and adaptive system since its runtime behaviour is driven by templates and variable definitions created and maintained by the end users, the medical professionals themselves.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com