Sentence examples for templates in which from inspiring English sources

These cDNA products served as templates, in which a 250 bp fragment common to both WT and transgenic rod opsin transcript species - beginning at the 3' of exon 4 and ending within exon 5 beyond the sites of mutagenesis – was amplified by PCR with the primers FACRhoEx4A (5' GGTCATCTACATCATGTTGAACAAGC 3') and mRh5 (5' TGAGGGAGCCTGCATGACCTCATCC 3').

Two forms were templates, in which the purpose of research was to be filled in upon use.

The QPs were produced in bundled stacks that were derived from the lamellar, amine-bilayer templates in which they grew (see Scheme 2 and Figures 2 and 4a).

Each item was reviewed using matrix templates in which a categorization of response issues was cross-tabulated against the list of respondents.> -wrap-foot> Note.

To obtain ternary Dpo4·DNA·dNTP complexes, γ-OH-PdG was site-specifically incorporated into two 18-mer templates in which the adduct was either in the 5′-CXG-3′ or 5′-TXG-3′ sequence context.

The script also attempts to use complexes generated from the BioGRID's interactions through a pattern-detection procedure as templates, in which case the newly generated complexes have the code 'N'.

Normally, I love any film — "The Dirty Dozen" being the template — in which a number of disparate die-hards club together to whack a common enemy.

In its early stages it does follow the familiar Grisham template, in which a lawyer finds himself unexpectedly in legal trouble.

But in other ways, the architects suggest, the project presents a post-recession template, in which function and use of a space almost take precedence over aesthetics.

Instead of following the Dreamliner template, in which it sought to create a revolutionary plane brimming with new technology, Boeing is now seeking a safer, more incremental path.

"This case has also provided a template in which a club's rival can bring about a significant ban for a top player without anything beyond an accusation," it said.