Your English writing platform
Discover LudwigSuggestions(2)
Exact(1)
Variability in amplification may be introduced from several sources, namely the relative amount of chloroplast DNA to total DNA ratio and the tendency for inhibitory compounds to co-purify with DNA templates in total DNA isolation [ 37].
Similar(59)
We believe that the use of templating in total knee arthroplasty should be interpreted with caution and we urge the development of more accurate prosthesis sizing techniques.
Groups of forward and reverse primers (250 nM each in the final reaction) were used to generate amplicons from 0.1 µg of genomic DNA templates in a total of 10 µl of solution mixing with 10 µl of Taq 2×Master Mix (New England Biolabs, Ipswich, MA).
Genomic DNA at 15.625 pg, 3.125 pg, 625 fg, 125 fg, 25 fg, 5 fg, and 1 fg DNA/reaction was used as DNA templates in a total volume of 25 μL.
A sample of 2 ng of total RNA was used as a template in a total volume of 20 µL.
PCR was conducted by using 1 µL of cDNA as template in a total volume of 20 µL.
Reactions contained 7.5 µl 2× SYBR MasterMix (Qiagen), primer (100 nM), and template in a total volume of 15 µl.
PCR reaction: 150 nM final concentration of forward and reverse primers, 6 µl of QuantiTect SYBR Green PCR Master Mix (Qiagen, Valencia, CA) and 50 ng of cDNA template in a total of 12 µl.
The PCR reaction consisted of 1x Q-Solution (Qiagen), 1x Buffer (Qiagen), 1 µM Primer 1 (5' GCGACTACGTGGTCTACTCG 3'), 1 µM Primer 2 (5' AGGACCCTCATGGCCTTG 3'), 200 µM dATP, 200 µM dTTP, 200 µM dCTP, 100 µM dITP, 100 µM dGTP, 0.3 units HotStar Taq (Qiagen), and 1 µl of DNA template, in a total volume of 10 µl.
2 μl of each cDNA were used as template in a total volume of 50 μl.
cDNA (20 ng) was used as template in a total reaction volume of 10 μl.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com