Your English writing platform
Discover LudwigSuggestions(2)
Exact(1)
If templates are conducted after randomisation and only in the focal arm, but a large proportion of men are then not suitable for focal therapy (therefore, they have radical therapy), this situation would be problematic from an intention-to-treat analysis.
Similar(59)
In vitro reconstitution of chromatin on linearized DNA templates was conducted using continuous dialysis from 1 M to 10 mM NaCl.
A parametric study of carbon nanotube (CNT) synthesis from catalytically active porous anodic Al Fe Al multilayer templates was conducted with respect to pore aspect ratio, Fe layer thickness, CNT synthesis temperature, and pre-anodization thermal annealing.
To reveal the discrepancy between the morphologies of the columnar structures, defect analysis of the substrate including the templates is conducted.
To check this, MSSCP analysis for RT-PCR proderivederived from different templates was conducted.
For each gene, three repeated experiments, including internal controls and negative controls (reaction samples without cDNA templates), were conducted.
Quality control of the sample libraries and quantification of the DNA templates was conducted using Agilent Technologies 2100 Bioanalyzer using Agilent DNA1000 chip.
PCR amplification of rps14, from either genomic or cDNA templates, was conducted using primers rps14F1 ATGWYGGAGAAGCRAAATAKA), rpl5F1 (ATGYTTCCRCTCHATWTTCAT), rps14R1 TACCAAGACGATTTCTTTATG), rps14R2 (GGACTAGCTGCAGAGCTAACC), nuS14F6B (CRCAAACGTAGAHTKCTYGC), nuS14F7 (GCKKGAYCRCAAACGTAGA), and nuS14R3 (CTACCAHGAYGCYTTCTTWAC).
A best match search of this template is conducted within a 28×28 pixel area of the previous and next frames.
PCR amplification using genomic DNA or cDNA as a template was conducted using HotStarTaq DNA polymerase (QIAGEN, Tokyo, Japan).
A comparative modelling approach (SWISSMODEL) using crystallised mammalian c-MYB (1GV2.PDB) as the structural template was conducted in order to study DNA binding domains from the previously selected MYBs.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com