Your English writing platform
Discover LudwigExact(3)
Collagen hydrogels were air-dried onto microgrooved templates and subsequently removed in the form of grooved CMs with the potential to align cells.
A series of biomorphic TiO2 photonic crystal (TiO2-BMPC) structures are fabricated through a sol gel method by using butterfly wings as templates, and subsequently gold nanoparticles (Au NPs) with an average size of about 9 nm are deposited in situ into the TiO2-BMPC.
Reactions were then heated at 90°C for 10 min in order to denature cDNA products from the RNA templates and subsequently transferred to 96-well plates prior to capillary electrophoresis.
Similar(57)
The optimum composition was achieved for a sample produced with 10 wt.% of template and subsequently heat-treated in air at 550 °C to remove the PGA.
The as-prepared micro/meso/macroporous TS-1 materials are treated by non-thermal plasma to remove the organic template and subsequently characterized by spectroscopy (DLS, IR, UV vis), microscopy (TEM, SEM), X-ray diffraction, nitrogen sorption and mercury intrusion porosimetry.
In this case, the layout generation is a semi-automatic process: while the initial diagram layouts are generated automatically, the user has to choose one of them as template and subsequently to align the residue centroids manually by means of certain meta-files.
This needs to be corrected by using the CT as the anatomical template and subsequently 'trimming' part of the GTVpet which is clearly in an air cavity.
Ten microlitres of master SYBR Green (Qiagen, Crawley, West Sussex, UK) was mixed with 6 μl of RNase-free H2O, 1 μl of each primer and 2 μl of cDNA template and subsequently loaded into each capillary.
α-synuclein1-110 the truncation mutant lacking the C-terminal amino acids 111-140 was engineered by standard PCR using the primers CACCATGGATGTATTCATGAAA (fwd), and CTATTCCTGTGGGGCTCCTT (rev), and the SNCA gene as a template, and subsequently cloned into a pET101D expression vector by TOPO directional cloning (Invitrogen) according to the manufacturer's instructions.
Informed by the finite element results, we proceed to fabricate specimens by additively manufacturing polymer templates, coating the templates with nanocrystalline nickel, and subsequently removing the templates resulting in free-standing, hollow truss cores.
Silica particles of 0.5, 4, 6, and 10 μm diameter were used in preparing templating photonic crystals and subsequently templated hydrogels.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com