The 1.7 kb fragment of HpDnaG was amplified using H. pylori genomic DNA (ORF Hp0012) as template and forward (5'-ACGGTCGACATGATTCTTAAAAGTTCCATTG-3') and reverse (5'-ACGGTCGACATATGGCGACTAATTCTCCTTG -3') primers having SalI restriction site and Taq DNA polymerase (5PRIME PCR Extender system, 5PRIME gmbH, Hamburg Germany).
Real-time PCR was performed by using the Rotor Gene Q system (Qiagen, Hilden, Germany) and a reaction mixture that consisted of SYBR Green 2 × PCR Master Mix, cDNA template, and forward and reverse primers.
Finally, the 81 or 60 aa of predicted luminal domain of AtGCSI, aa 70 to aa 150 or aa 91 to 150, were subcloned between XYLT35 and GFP using PCR reaction with AtGCSI cDNA as template and forward primer FGCS80 or FGCS60 (see table 2 for primer details) and reverse primer R150 (see above) with respectively KpnI or BamHI site (underlined) to sub-clone into pBLTI121.
The C1392S, the S1394A and the C1392S/S1394A mutants were generated by site-directed mutagenesis with the Quick Change Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA) according to the manufacturer's directions using Flag-HD-PTP full-length and catalytic domain constructs as templates and modified forward and reverse primers described in figure S1.
All ssDNA templates and the forward and reverse primers were purchased from integrated DNA technologies (IDT).
We examined the extent of replacement of wild-type copies of individual genes after each mutagenesis by PCR, using DNA isolated from wild-type and mutant cells as templates and appropriate forward and reverse primers (Fig. 1 and Supplementary Table S2).
The spike-in DNA was generated by PCR using wild-type genomic DNA preparation as template DNA and forward ('STG246': cttgcgatttttgcttctcc; complementary to the yyaD locus) and reverse primers ('STH602': ttatcgtgcgaaagcagttg; complementary to the gidA locus) producing a DNA fragment of 7238 bp in size covering the parS-359 site within the parB gene.
For generation of the construct encoding tagRFP-CINCCKVL, tagRFP was amplified by PCR using pTagRFP-C as template and oligonucleotides, forward 5'- CCGCTandGCTACCGGTCGCCACCATGG-3' and reverse, 5'- CCGGATCCCTAGAGGACCTTGCAACAGTTGATACAATTAA GTTTGTGCCGGATCCCTAGAGGACCTTGCAACAGTTGATACAATTAA
The construct encoding GFP plus the last 22 amino acids of RhoB was generated by amplifying GFP with a BssHII site at its 3' end, using pEGFP-C1 as a template and primers, forward 5'-GAGTAGAAGCTTATGGTGAGCAAGGGCGAGGAG-3', and reverse 5'-CATCTTGCGCGCGTCTTGTACAGCTCGTCC-3'.
Blackcurrant cDNA inserts were amplified by PCR using plasmid DNA template and M13 forward and reverse primers that span the multiple cloning site of the vector.
