Sentence examples for template with two from inspiring English sources

The open-composition can be defined by a template with two component types.

Open image in new window Fig. 2 The caDNAno decoration of a DNA nanotube-based template with two sticky ends.

a Multiplex PCR assay was carried out using a Triticum aestivum genomic DNA template with two forward primers (390F, 434F) and one reverse primer (542R).

3' RACE was performed using RT-PCR product as template with two nested gene-specific sense primers, GPS1 (5'GCCCTandTCCAACGPS2GTAG3') and GPS2 (5'CAACCGTGAGTGTCCTAATCAG3'), following the specification of 3'RACE kit (Takara, Shiga, Japan).

First, this region was amplified by using genomic DNA of E. faecalis V583 as a template with two primers combinations faecalis A ter and faecalis C ter, and faecalis B ter and faecalis D ter, thus introducing ApaI and SalI, and SacI and NotI restriction sites, respectively.

The K-REC currently consists of a clinical scenario template, with two 'tested' scenarios.

Amplification was carried out by using extracted genomic DNA as template with three chloroplast DNA (cpDNA) regions (trnL-F, rbcL and psbA-trnH 43,44,45. psbA-trnH 43,44,45

Bosentan and its high-affinity analog K-8794 contain many aromatic moieties composed of a central pyrimidine template with four substituents: a 2-pyrimidyl, a 4-sulfonamide, a 5-phenol, and a 6-hydroxyl (Fig. 3a).

An ingenious unimolecular DNA template with three functional parts has been designed: 5′-fragment as the miR-21 recognition unit, middle fragment as the miR-21 analogue amplification unit, and 3′-fragment as the 8 17 DNAzyme production unit.

A custom template with six tissue classes was used for unified segmentation and normalization.

We slide the patch over the recognition template with four pixels forward to ensure a sufficient feature-level difference.