Suggestions(1)
Exact(1)
We applied the search template, with minor modifications to optimize and enhance the search outcome of individual databases, to 11 databases that had a potential coverage for the areas of osteopathic medicine, allopathic medicine, chiropractic, and physical therapy.
Similar(59)
Using homozygous genomic DNAs, we produced bi-allelic templates with increasing minor allele:major allele proportions (9 1, 8 2, 7 3, 6 4, 5 5, 4 6, 3 7, 2 8, 1 9).
Small interfering RNA specific to the mouse hepc1 (ACAGAUGAGACAGACUACAdTdT) was described previously [ 25], and we used this template to design the corresponding shRNA (ACCGACAGATGAGACAGACTACATTCATGAGATGTAGTCTGTCTCATCTGTCTTTTT) with minor modifications (Invitrogen, Shanghai, China).
The following basic PCR protocol was used with minor variations: 50 ng of genomic DNA template, 1 × PCR reaction buffer, 2 mM MgCl2, 0.25 mM of each dNTP, 10 pmol of each primer and 1 unit of Taq DNA polymerase.
Template DNA from stool isolates was used in multiplex PCR to investigate the presence of toxin genes, as described elsewhere, with minor modifications [ 12].
He survived with minor injuries.
Hannah survived with minor injuries.
(Brown doesn't bother with minor artists).
All six escaped with minor injuries.
With minor qualifications, each answered "none".
All of them escaped with minor injuries.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com