Sentence examples for template the two from inspiring English sources

When there is no template, the two probes combine to form a complex probe and therefore no fluorescence is produced; when there are templates, the fluorescent probe hybridizes with the templates first, and the fluorescence is not quenched.

Using the genomic DNA of E. coli DH5α as template, the two genes encoding Fld and FdR were amplified with the primer pairs of Fld-BamHI-F/Fld-SalI-R and FdR-BamHI-F/FdR-SalI-R, respectively.

To circumvent the difficulties we encountered in obtaining high quality crystals, we resorted to homology modeling of TaOMT2 using Medicago sativa MsCOMT [ 16] as a template; the two proteins share 63% sequence identity.

Three orthopaedic surgeons (AJC, SL and JCB) independently templated the five tibiae with both trays on two separate occasions.

By using the recombinant plasmid pET-28a-Tspox as template, the four mutant plasmids bearing K312E, E539K, T166A/E539K and K312E/E539K substitutions were obtained.

After removing the templates, the two kinds of synthesized PIPs were used to adsorb natural BiP or FKBP23 from ER extract; both showed high selectivity.

This intron was PCR amplified using pIGI121Hm [ 41] as template and the two adapter/primer sequences: 5' CGACGGACCGATCTAGAACATGGATCCCTACAGGGTA and 5' TCAGCTGCAGACTAGTTACAGGACGGACGAGTCGACGGTTC.

Conventional TaqMan detection chemistry requires that the probe is complementary to the region within the amplified portion of the template between the two amplification primers.

In the first step, eYFP-His was amplified using pIVEX1.3_eYFP-His as a template and the two gene-specific primers 9 and 10 (Additional file 2).

Data were mapped on the flatmap template and the three dimensional cortical template of the atlas.

Structural templates for the two LGI1 domains were found using MANIFOLD [32] and MetaServer [33].