Sentence examples for template the second from inspiring English sources

Using these first round PCR products as template, the second round PCR was performed to separately amplify exons 6 and 8.

Using the products of the initial round as template, the second round of PCR was performed using primers "a" and "d" (or "e").

Using 5 μl of the PCR product from first amplification as template, the second round of nested PCR was conducted with a primer specific.

In this study, we engineered a highly efficient, soft, hydrophilic CuO chitosan (CS) NF template, the first of its kind.

By using this anchor-cDNA as the template, the first and the nested PCRs were carried out with 2 sets of primers, anchor-1/ORF1-R14 anchor-2/ORF1-R13 anchor-2/ORF1-R13 anchor-2/ORF1-R13

Two overlapping fragments were amplified using pCI-Trim17 as template, the first with primers 5′ CGAGAATTCTGAGCCATGGATGC 3′ and 5′ CAATGTACTGTTTGGAAGTAGGGACAGCTGTTTTTTCC 3′, the second with primers 5′ CTACTTCCAAACAGTACATTGGTCACTCTCACAGAGCC 3′ and 5′ GACTCTAGACTATCCCTTCACCCACATGG3 ′.

Using the 7 as a template, the fourth and sixth cards you deal would be placed underneath the the Jack, while the fifth card would be placed under the Ace and the 7.

The PCR product was diluted 100-fold and used as the template for the second step.

One microliter of the product was used as the template for the second PCR reaction.

The resulting PCR product was used as template for the second PCR with primers P304 and P295.

The resulting PCR product was used as template for the second PCR with primers P308 and P295, resulting in the fragment 6xHis-IFP.