Sentence examples for template the relative from inspiring English sources

By comparison of expression levels with a mock digested template, the relative amounts of methylated and unmethylated DNA can be calculated [ 23, 24].

In template generation, the relative position of to is recorded in ; in contour matching, the pixel value on the assumed position of is incremented by 1 on the detection map.

In addition to the visual interpretation of FDG-PET images, the so-called statistical image analysis such as 3D-SSP is often used, in which the subject brain image is spatially normalized into a template and the relative regional uptake is compared voxel by voxel with the normal database to generate a z-map or t-map of significant hypometabolism [12, 13].

When analyzing low template copies, the relative expanded uncertainty of the ddPCR system was slightly lower than the values of 30 56% and 40 60% reported recently for a 765-cdPCR assay containing either 16 or 128 copies, respectively.

Human GAPDH was amplified with the primers described by Zhang et al. [ 29]: forward 5′-ATCCCATCACCATCTTCCAG-3′ and reverse 5′-CCATCACGCCACAGTTTCC-3′. For semi-quantitative RT-PCR, 40 ng of total RNA was used as template and the relative amount of mRNA in different samples was calculated by measuring the band intensity (normalized to GAPDH) using NIH ImageJ software [ 30].

qPCR was performed in a total reaction volume of 20 μL, containing 10 μL of 2 × real-time PCR Mix (containing SYBR Green I), 0.4 μL of each primer (10 mmol/L), 2 μL of cDNA template from the relative samples (100 ng/μL final concentration), and 7.2 μL water in CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, USA).

For the primer extension assay used to quantify transcription products, a reverse primer (5′ GCCATTGGGATATATCAACGGTGG 3′) starting at position +155 (+192 for the 'L' DNA template) relative to the transcription start site was used.

Distinct morphologies result depending on the template pre-treatment, synthesis temperature, template dimension and the relative polarity of the porogenic solvent.

The influence of template size on the relative sequencing efficiency was analyzed by generating templates with a wide range of fixed sizes using FseI and MseI, a methylation insensitive restriction enzyme that recognizes the four base sequence TvTAA.

Of the resulting cDNA, 30 ng/μl was used as the template to quantify the relative content of mRNA by real-time PCR (ABI PRISM 7700 sequence detection system, Applied Biosystems, Foster City, CA USA) using respective primers and SYBR Green.

A 1 10 dilution of the resulting cDNA was used as a template to quantify the relative content of mRNA by real-time PCR (ABI PRISM 7700 Sequence Detection System) using respective primers and SYBR Green.