Sentence examples for template the first from inspiring English sources

In this study, we engineered a highly efficient, soft, hydrophilic CuO chitosan (CS) NF template, the first of its kind.

By using this anchor-cDNA as the template, the first and the nested PCRs were carried out with 2 sets of primers, anchor-1/ORF1-R14 anchor-2/ORF1-R13 anchor-2/ORF1-R13 anchor-2/ORF1-R13

Two overlapping fragments were amplified using pCI-Trim17 as template, the first with primers 5′ CGAGAATTCTGAGCCATGGATGC 3′ and 5′ CAATGTACTGTTTGGAAGTAGGGACAGCTGTTTTTTCC 3′, the second with primers 5′ CTACTTCCAAACAGTACATTGGTCACTCTCACAGAGCC 3′ and 5′ GACTCTAGACTATCCCTTCACCCACATGG3 ′.

The first lane for each concentration contains template, the second is template-free.

Using these first round PCR products as template, the second round PCR was performed to separately amplify exons 6 and 8.

Using the products of the initial round as template, the second round of PCR was performed using primers "a" and "d" (or "e").

Using 5 μl of the PCR product from first amplification as template, the second round of nested PCR was conducted with a primer specific.

Using the 7 as a template, the fourth and sixth cards you deal would be placed underneath the the Jack, while the fifth card would be placed under the Ace and the 7.

Red curve with stars: correlation values between the template and the first derivation curve in function of the position of the template.

Using the JV template for the first time?

Their lineup – male diva Marc Almond, keyboard wiz Dave Ball – set the template for the first half of the 80s.