Sentence examples for template sequence from inspiring English sources

Initial copy number of each template sequence in parentheses.

Cloning orientation of P53 template sequence (5′ to 3′) was from the T7 promoter sequence to the M13 reverse priming site.

Template sequence was amplified using specific B-cell mRNA, specific p53 PCR primers (forward TGCTCACCCTGGCTAAAGTT; reverse: TCTTCTGTACGGCGGTCTCT) and Pfu Ultra II Fusion HS polymerase (Agilent).

To validate these predictions, we developed a quantitative PCR (qPCR) assay to report on template depletion by Cas9 cleavage using guide sequences and a 1 kb template sequence derived from the human AAVS1 locus.

This simple and cost-effective 3TICA strategy is promising for the detection of any short oligonucleotides, simply by altering the target recognition unit in the template sequence.

The systematic, exhaustive template sequence combined with a rigorous, multitechnique investigation protocol affords a unique data library and a complete set of reliable interpretative/predictive guidelines.

Peptide mutants of the template sequence (112YLEIEFCLKHR122) were synthesized and initially screened for their inhibitory effect on RANK RANKL binding by competitive ELISA.

All peptides examined showed inhibitory activity when compared with no drug present, and the novel peptide sequences outperformed the native template sequence used for the design.

The ribonucleoprotein enzyme telomerase synthesizes telomeric DNA by copying an internal RNA template sequence.

Three 60-mer sense probes were selected across the length of the template sequence.

These keys pointed to a list of template sequence identifiers.