Sentence examples for template relative to from inspiring English sources

Exact(5)

(iv) In assays carried out with purified 3D in vitro, the enzyme with M296I showed decreased incorporation of RTP oposite C or U in the template, relative to the wild type enzyme.

By founding subcolonies with the progeny of single inseminated females (Benedict and Rafferty 2002), Howell and Sutcliffe were able to substantially reduce the polymorphism in tissue used for genomic DNA template relative to the original colonies.

The kinetic signatures for each cytosine modification type are shown in Figure 1 as ratios of the average IPD value at each template position of the modified template relative to the unmodified control.

For the primer extension assay used to quantify transcription products, a reverse primer (5′ GCCATTGGGATATATCAACGGTGG 3′) starting at position +155 (+192 for the 'L' DNA template) relative to the transcription start site was used.

We reasoned that increasing the levels of gtbp-1 crRNA and template relative to that of dpy-10 should increase the frequency of gtbp-1 edits overall, including in the nonroller population.

Similar(55)

Specific examples where this approach has generated either significant modifications of existing molecular frameworks or structurally new molecular templates relative to design starting points (i.e., lead hopping) will be provided.

The polymerase switching is thought to be mediated by, among other factors, the post-translational modification of the replication processivity factor PCNA. Translesion synthesis polymerases often have low fidelity (high propensity to insert wrong bases) on undamaged templates relative to regular polymerases.

The bypass efficiency for the mutant is significantly diminished on unadducted templates but not the dA-adducted templates relative to wild-type enzyme.

Figure 2 shows the plasmid-wide view of IPD ratio data for the in vitro methylated and the mTet1-converted templates relative to the unmodified control.

In addition, the ND3 locus achieved a high specific yield of > 500% in the quantitative real-time PCR, possibly as a result of the high efficiency of the multiple displacement amplification on circular DNA templates, relative to linear fragments.

Using this setup, we were able to clearly differentiate fluorescent signals obtained from PCR reactions performed in a conventional thermal cycler with samples containing as little as 9.6 ag of template DNA relative to a template-free negative control.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: