Sentence examples for template quantifies the from inspiring English sources

Exact(1)

The template quantifies the differences in intervention delivery between best practice primary health care for the Indigenous population via Aboriginal Community Controlled Health Services (ACCHSs), and mainstream general practitioner (GP) practices.

Similar(59)

PCR was carried out using the QuantiTect Multiplex Kit (Qiagen, Hilden, Gemany) with 0.3 μM of each primer (forward: GTTTTTTGGATAGTTAGGTAAT, reverse: CCTCCTACCTTCTAACCC), 1 μM blocker (TAATTTTTGTTTTGTTTGTTTGATTGGGGTTGTATGA-SpacerC3), 10 ng DNA template (quantified via UV spectrophotometry) and 1 40,000 diluted SYBR Green I DNA dye (Biozym Scientific, Oldendorf, Germany) in 20 μl per reaction.

The centrifugation method, which is proposed here, employs the wetting process onto the wall of the alumina template while quantifying the infiltration forces that permeate the nanochannels.

The radiologist had been previously trained in using a transparent grid template to quantify the total breast area and the area composed of dense tissue.

Of the resulting cDNA, 30 ng/μl was used as the template to quantify the relative content of mRNA by real-time PCR (ABI PRISM 7700 sequence detection system, Applied Biosystems, Foster City, CA USA) using respective primers and SYBR Green.

A 1 10 dilution of the resulting cDNA was used as a template to quantify the relative content of mRNA by real-time PCR (ABI PRISM 7700 Sequence Detection System) using respective primers and SYBR Green.

The 1 μg of total RNA was transcribed into cDNA by using the iScripTM cDNA synthesis kit (Bio-Rad, Hercules, CA, USA), and 40 ng/μl of the resulting cDNA was used as the template to quantify the relative content of mRNA by using QuantiTect SYBR Green PCR kit (Qiagen) with DNA Engine Opticon 2 Continuous Fluorescence Detection System (MJ Research, Waltham, MA, USA).

The 'Indigenous Health Service Delivery IHSDD) Template' has been developed, which quantifies the differences in how health interventions are delivered to the Indigenous population via ACCHSs compared to mainstream general practitioner (GP) based services, the latter being the standard form of primary health care available in Australia.

In this contest, we propose a rapid and reliable methodology based on Isothermal Titration Calorimetry (ITC) coupled with confluent cell layers cultured around biocompatible templating microparticles to quantify the number of overexpressing receptors on cell membrane and study the energetics of receptor-ligand binding in near-physiological conditions.

To verify the superiority of Method A, we quantified the template amount using the MultiNA Microchip Electrophoresis System DNA-500 Kit.

As a result, the Ct values can therefore be used as a measure of template DNA and to quantify the relative amount of 3895 bp deletion compared to wild-type mtDNA.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: