PCR amplification using genomic DNA or cDNA as a template was conducted using HotStarTaq DNA polymerase (QIAGEN, Tokyo, Japan).
A comparative modelling approach (SWISSMODEL) using crystallised mammalian c-MYB (1GV2.PDB) as the structural template was conducted in order to study DNA binding domains from the previously selected MYBs.
PCR utilizing genomic DNA as a template was conducted in a total volume of 50 μl, which contained approximately 100 ng of genomic DNA, 300 nM of each primer, 0.2 mM dNTPs, 1.5 mM MgCl2, and 2.6 units of the Expand High Fidelity enzyme mix in 1x Expand High Fidelity buffer (Expand High Fidelity Plus PCR System, Roche Applied Science, Basel, Switzerland).
To reveal the discrepancy between the morphologies of the columnar structures, defect analysis of the substrate including the templates is conducted.
In vitro reconstitution of chromatin on linearized DNA templates was conducted using continuous dialysis from 1 M to 10 mM NaCl.
A parametric study of carbon nanotube (CNT) synthesis from catalytically active porous anodic Al Fe Al multilayer templates was conducted with respect to pore aspect ratio, Fe layer thickness, CNT synthesis temperature, and pre-anodization thermal annealing.
To check this, MSSCP analysis for RT-PCR proderivederived from different templates was conducted.
For each gene, three repeated experiments, including internal controls and negative controls (reaction samples without cDNA templates), were conducted.
Quality control of the sample libraries and quantification of the DNA templates was conducted using Agilent Technologies 2100 Bioanalyzer using Agilent DNA1000 chip.
PCR amplification of rps14, from either genomic or cDNA templates, was conducted using primers rps14F1 ATGWYGGAGAAGCRAAATAKA), rpl5F1 (ATGYTTCCRCTCHATWTTCAT), rps14R1 TACCAAGACGATTTCTTTATG), rps14R2 (GGACTAGCTGCAGAGCTAACC), nuS14F6B (CRCAAACGTAGAHTKCTYGC), nuS14F7 (GCKKGAYCRCAAACGTAGA), and nuS14R3 (CTACCAHGAYGCYTTCTTWAC).
