Your English writing platform
Discover LudwigExact(1)
Here the template introduces a topic (smoking), which seems tangential to this patient's particular circumstances, although it is important to asthma care in general terms, and has institutional significance, being a QOF indicator.
Similar(58)
Known amounts of IAC template introduced in the multiplexed qPCR mastermix enabled reliable quantification of inhibition in the Aspergillus or extraction control qPCRs.
Demographic and CPR-related data were collected at the emergency department immediately after hospital admission and after 6, 12, 24, 72 and 120 hours at the intensive care unit via a web-based data entry system using an Utstein-Style like template, introduced by the German Society of Anaesthesiology and Intensive Care Medicine [ 25].
Building on the enzyme copying approach used by the Swiss chemist Charles Weissmann in his studies on bacteriophage RNA, Sanger began using the enzyme DNA polymerase to make new strands of DNA from single-strand templates, introducing radioactive nucleotides into the new DNA.
Electronic templates introduced to assure quality of care in chronic disease management may privilege the needs of the institution for data over the particular needs of individual patients.
Spatial normalization to an atlas template can introduce additional variance.
The suicide plasmid was used as a template to introduce mutations into the mreC gene by inverse PCR.
The pre-polymer solution containing the template was introduced into the polypropylene hollow fiber segment for in situ polymerization.
After all, Traveller's Tales hasn't strayed much from the basic gaming template it introduced with its first Lego Star Wars instalment in 2005, and in the games industry, innovation is as expected as it is prized.
Most student labels follow the template Columbia introduced: find an artist to submit a finished recording, put together a CD and release and market it over the span of a semester or two.
The plasmid pIM26 encoding E194GAGmut was engineered using pIM32 as template and introducing mutations in the E194 gene with the QuickChange II site-directed mutagenesis kit (Stratagene) and oligonucleotides 5′-GGTTAACTGGGAGGCGATAGGAGCGACTGCGGCCCCTCTTAATGCAGCTGTTGCAAACGGTGACTTATGG -3′ and 5′-CCATAAGTCACCGTTTGCAACAGCTGCATTAAGAGGGGCCGCAGTCGCTCCTATCGCCTCCCAGTTAACC -3′.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com