Your English writing platform
Free sign upExact(36)
Normally, I love any film — "The Dirty Dozen" being the template — in which a number of disparate die-hards club together to whack a common enemy.
In its early stages it does follow the familiar Grisham template, in which a lawyer finds himself unexpectedly in legal trouble.
Instead of following the Dreamliner template, in which it sought to create a revolutionary plane brimming with new technology, Boeing is now seeking a safer, more incremental path.
But in other ways, the architects suggest, the project presents a post-recession template, in which function and use of a space almost take precedence over aesthetics.
"This case has also provided a template in which a club's rival can bring about a significant ban for a top player without anything beyond an accusation," it said.
It is a ritual woven into our lives as "their stories" become ours, a mirror that not only reflects matters of civic concern, that packs a wallop as a crime show and is wittier than most (streetwise suspects with "priors" know the angles and how to deal better than any law student), but also serves as a template in which we vicariously act out and perhaps exorcise little conflicts of our own.
Similar(24)
We have termed the process templating, in which the crystallization behaviour of the bulk of the system (∼90% branched material) is completely altered (spherulitic to oriented lamellar) by mapping it onto a pre-existing minority structure (∼10% linear polymer).
We introduce the notion of local-templates in which each mobile agent – capable of simple forward/backward movements and a clock-wise/counter clock-wise spin – actively encodes distinctive information into multiple non-overlapping sectorial regions of the surrounding environment in order to form pose-specific virtual links with similar minimalist agents in a local neighborhood.
In the DEC assay, the formation of a stable complex between the enzyme and a primer-template in which the 3' terminus is blocked is measured as a function of nucleotide concentration.
These cDNA products served as templates, in which a 250 bp fragment common to both WT and transgenic rod opsin transcript species - beginning at the 3' of exon 4 and ending within exon 5 beyond the sites of mutagenesis – was amplified by PCR with the primers FACRhoEx4A (5' GGTCATCTACATCATGTTGAACAAGC 3') and mRh5 (5' TGAGGGAGCCTGCATGACCTCATCC 3').
Two forms were templates, in which the purpose of research was to be filled in upon use.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.
Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com