Your English writing platform
Discover LudwigExact(2)
Iraq adopted the red-white-black template in use in Egypt and Syria, and put three stars in the center to signify a dream of eventual union with them.
The template in use at our institution appears in Table 2.
Similar(58)
To explore the complexity of balancing these two goals, this study analyzes the differences and similarities between templates in use today.
There are no templates in use by the DataUp tool.
The framework for incorporating these models is now well-defined, with templates in use for creation of codes for CHASTE simulations and for the graphical user interface itself.
The immunoprecipitated DNA was used as template in PCR using primers: ANF: (agtaagaatgcggctcttgc), (gagacagaaccctccccatt), CTNNB1-P: (tcgacaaacgtcaattttgc), (tcgattaagcagcctccaat), GATA4-P: (cccttcagccttaagttcc), (gcgacacacttagggtttcttc), and CTNNB1-E (cacccggaggtgatttacaca), (gcctggctctgatctccatgt).
The cDNA was subsequently used as the template in PCR, using oligos #798 + #376 and #798 + #373 for fadD1 and fadD2, respectively.
The cDNA (1 μL) was used as a template in PCR using specific primers for TTC40 (exons 5-6, under Accession number NM_001200049.2) and β-actin.
The deposition area can be adjusted by controlling the dipping area of the CNT nanoneedle template in electrolyte using a microstage.
We conclude that both types of trans-splicing seen at a single locus can be readily reproduced on a purified template in vitro using reverse transcriptase.
The data in Experiments 1 and 2 were then spatially normalised to a standard EPI template in SPM using non-linear basis functions.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com