Sentence examples for template in the second from inspiring English sources

Briefly, samples were first submitted to a PCR using two primers: D75 = 5'– CAGATCTTGGTTGGCGTAG 3' and D72 = 5'– TTTTCAGAATGGCCGAACAGT–3'). Two microliters of these PCR products were used as template in the second PCR round performed in a real time PCR apparatus (ABI7900 - Applied Biosystems), using the primers: D71 (5'-AAGGTGCGTCGACAGTGTGG-3') and D72.

Two microlitre of the first round PCR reaction were used as template in the second round.

PCR mixture of 1st round in 50 times dilution was used as the template in the second round (2nd round).

One microliter of the first PCR reaction product was used as a template in the second PCR round.

The resulting product of 603 bp was used as a template in the second PCR amplification in the presence of Leishmania-specific primers.

One μl of the 50-fold diluted first PCR product was used as the template in the second PCR with primers SPLKFwd_2 and hsplam5.

The ligation reaction was purified with QIAquick PCR Purification Kit (Qiagen N.V. Venlo, The Netherlands) and used as template in the first PCR reaction performed with 50 pmol of a specific oligo and 5 pmol of PCRlinker I.

In the first-round PCR, 10 100 ng of sample DNA was used as a template; in the second-round reaction, 1μl of the first-round products were used.

All the graphs start off from zero and because the template assigned to the first image is used throughout the sequence, the results are independent of which vertebral landmarks are chosen to define this template in the first instance.

The splinkerette adaptor was ligated to genomic DNA digested with Spe I and Xba I, and the ligation product was used as the template in the first PCR reaction with primers SPLKFwd_1 and hsplam3.

By enriching the target sequence from the genomic template in the first phase of the TSP reaction, a set of nested locus-specific primers designed for maximal detection sensitivity can be used without concern for interference by other factors that would otherwise confound SNP detection.