Sentence examples for template for short from inspiring English sources

When I was writing my first collection, most of my stories fell somewhere in the seven-thousand-word range, I think because that was for whatever reason my mental template for "short story length".

These large mtDNA products were subsequently used as template for short-range PCR of 0.5 1.5 kb using conserved primers (see Additional file 1).

To genotype the Ildr1 k allele, genomic DNA was extracted and used as the template for short-range PCR using the forward primer (5′TAATGCAGACAGGCTTTGGA), and the reverse primer (5′GCGAACTTCCCTCTGATTGT) for the wild-type allele to yield a 233 bp PCR product.

Another advantage of direct delivery is that the entire protocol requires no cloning: tracrRNA, crRNAs, and ssODN repair templates for short edits (<50 bases) are all synthesized chemically, and longer repair templates are made by PCR using oligonucleotides to code for the short (35-base) homology arms.

The melting curves that we generated from the PCR amplicons by applying the respective FRET probes were fed into the MAAQ process to determine the relative quantities of each target cDNA sequence with respect to the competitor template (T/C for short).

Bismarck used the king's telegram, called the Ems Dispatch, as a template for a short statement to the press.

HDPs are widely diverse in sequence and structure, and this wide repertoire provides an extensive template for designing short synthetic peptides with optimized activities and reduced cytotoxicities [ 11- 13].

Of course, there are limitations to using a partial genome as a template for mapping short reads since homologous reads from distal parts of the genome could map to the sub-genome assembly.

Remember that your article should only have an {{inuse}} template for a short while.

These long-range products were subsequently used as template DNA for short-range PCRs to generate overlapping fragments 0.5 3 kb in length.

This is due to that fact that Grubisic (2012); Grubisic et al. (2013) and Al-Yahya (2014); Al-Yahya (2011) defined only two generation strategies and stem templates for generating short answer questions.