Sentence examples for template derived using from inspiring English sources
Probes for Cdx2 were made using PCR-generated DNA template derived using Cdx2F1/ Cdx2R1T7 primer pairs for anti-sense probe and Cdx2F1T7/ Cdx2R1 primers for the sense probe (Cdx2F1 TCGCCACCATGTACGTGAGCTACCT; Cdx2F1 TCGCCACCATGTACGTGAGCTACCT Cdx2F1 TCGCCACCATGTACGTGAGCTACCTTACdx2F1 TCGCCACCATGTACGTGAGCTACCTACdx2F1 TCGCCACCATGTACGTGAGCTACCT.
RNA FISH Probes Probes for Cdx2 were made using PCR-generated DNA template derived using Cdx2 F1/ Cdx2 R1T7 primer pairs for anti-sense probe and Cdx2 F1T7/ Cdx2 R1 primers for the sense probe (Cdx2 F1—TCdx2ACdx2GTACdx2AGCdx2Cdx2Cdx2 R1—TTCdx2Cdx2GGGAGGGGTCdx2G; Cdx2 F1T7—TAATACdx2TCdx2ATAGGGATGTACdx2AGCdx2Cdx2; Cdx2 R1T7—TAATACdx2TCdx2ATAGGGAGGGGTCdx2GGGTGACdx2.
The pre-let-7a-1@1, pre-let-7a-1@2, pre-let-7a-1@3, and pre-miRNA-363@1 pre-miRNA-363@1 pre-miRNA-363@1templates of the were-type pre-miRNAs.
Finally, amino acid sequence alignment between the target (Cry1Ab15) and template protein was derived using the MEGA4 software [ 15].
Furthermore, a new low-complexity demodulation scheme was also derived using synchronized aggregate templates.
These ORF clones were derived using the human MGC collection as template and were produced in two formats: with and without stop codons.
Models were derived using backwards selection.
In brief, the 16S rDNA fragments were PCR amplified on genomic DNA as template derived from microbial populations using the 27F-fluorescence labeled and 1492R unlabeled primers.
Six classes of nonpeptide bradykinin antagonists were designed using a template derived from structural studies of peptide antagonists.
Isolation of these putative orthologues in wheat was carried out through direct sequencing of RT-PCR products using cDNA template derived from a mixed tissue sample containing several stages of developing leaves, spikes, carpels and seeds.
Clean production lots of amplification enzymes were screened and identified by using 10 fg bacterial DNA as template and showing >90% of the sequencing output using the amplified DNA was template derived.
