Your English writing platform
Discover LudwigExact(1)
It will appear in the template as two lines of things to do following the above instructions.
Similar(58)
At the gradient annealing temperatures from 64 ~ 69°C, the WT template, as well as two clones (D112K-1 and D112K-3) oft ofiveve randomly collected from the transformants without Dpn I digestion, showed detectable products only at annealing temperatures of 64 and 65°C, whereas the other three clones (D112K-2, D112K-4 and D112K-5) maintained detectable up to 67°C or higher.
Through analyses of a database of AlPO synthesis with ca. 1600 reaction data, we identified a number of synthetic parameters such as three gel molar ratios of Al2O3, P2O5 and the organic amine template, as well as eleven parameters associated with the geometric and electronic characteristics of the templates deemed to be useful in distinguishing (6,12 -ring-containing AlPOs from the other AlPOs.
In a brilliant summation of his comedy oeuvre, including The League of Gentlemen, Psychoville and Inside No 9, he describes the template as: "Three people in a room.
These failures cannot be attributed to the template as three other reads were successfully sequenced from the same source clone.
Cut out the template as one piece, making sure not to cut into the square shape.
Alongside these reactions, a series of serial-diluted templates as well as two no-template controls were also included to confirm the efficiency and specificity of the reactions.
Almost all of the students included materials, equipment, and actions in their reports, again reflecting the fact that the 'procedure' of the experiment is the dominant information captured in the report, although the pattern of information captured is different between the two templates, as can be seen in Fig. 10.
The resulting cDNAs were used as template for two round PCR as described above for whole blood FV gag amplification.
Plasmid pET15b/eIF4AIIP was used as template for two PCR reactions, using either (i) primers DraIII Forward and T Reverse and (ii) T Forward and BamHI Reverse.
3' RACE was performed using RT-PCR product as template with two nested gene-specific sense primers, GPS1 (5'GCCCTandTCCAACGPS2GTAG3') and GPS2 (5'CAACCGTGAGTGTCCTAATCAG3'), following the specification of 3'RACE kit (Takara, Shiga, Japan).
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com