Sentence examples for template as specified from inspiring English sources

The tiles, meanwhile, have been badly bodged, cut by hand on site rather than water-jet cut to a template as specified, leaving edges that look like broken teeth.

More specifically, PGM emulsion PCR reactions utilized the Ion Xpress 200 Template Kit (Life Technologies) as specified by the vendor.

Probe templates were radiolabeled as specified for the DECAprime II kit (Ambion).

As specified in the input template, the flux dataset can comprise values representing different samples and varying conditions.

Each gene target was tested in duplicate or triplicate, as specified, from ≥2 RNA templates prepared from independent bacterial cultures.

Information from the various sources is converted into a uniform standard format as specified in the Zebrafish GenomeWiki template.

The references passed to templates are Java objects that implement standard interfaces, as specified by the Java Metadata Interface (JMI) standard.

DNAs were isolated using the Quantum Prep miniprep kit (BioRad, Hercules, CA, USA) as specified by the manufacturer for use as template in polymerase chain reaction (PCR).

Five nanomolar primer-template (primer as described above, template sequence 5' CGCAGTATCCCGATTTACAACGTCGTGACTGGGAAAACCCTGGCGT) was blocked by incubation (10 minutes, 37°C) with 10 nM HIV-1 RT (wild-type or mutant, as specified) and 5 µM AZTTP in reaction buffer B (reaction buffer B was similar to buffer A, but contained 32 mM KCl).

For instance, the attribute "mitral valve regurgitation" references the template "regurgitation" which states that it is a special kind of regurgitation, and that this attribute should accept the same values as specified for the more general attribute.

He's doing his job as specified.