Sentence examples for template as for from inspiring English sources

The second side information update considers the same cross template as for the previous progressive scheme with two sets of blocks (Section 4.1).

The standard curve of each gene was constructed from real-time PCR results using dilution series of the PCR product made by the same primer pair template as for real-time RT-PCR.

Gene-specific primers Ba_TPI_207U (TTCGGCTGAGATGATAAAGG) and Ba_TPI_473L (AGTACCAATGGCCCACACTG) were designed within the Tpi sequence to amplify an intronic region, using the same genomic template as for the AFLP reactions.

using the same template as for the full texts above.

Designers have borrowed its contours as a template for as long as ufologists have reported sightings.

It is correct for the number of reverse templates to be slightly less than half of the total number of templates, as for some reactions, both the forwards and the reverse path follow the same template.

Almost since its inception, WordPress has issued the template as the default for everyone who signs up for an account.

Bobick and Davis [8] propose the temporal templates as models for actions.

Each of these pools was used as template for PCR analysis as described below.

For this, RNA was first extracted from blood stage parasites in order serve as template for cDNA synthesis as follows.

They serve as soft template and as storehouse for the acid dichloride.