Sentence examples for template and introduced from inspiring English sources

For generation of LC13/ABCD3/HLA-B*44:03, we used PDB structure 3KPS as a template and introduced mutations Y116D (numbers according to PDB numbering) and D156L to the MHC thus changing the HLA type from B*44:05 to B*44:03.

For generation of LC13/ABCD3/HLA-B*44:02 we used PDB structure 3KPS as a template and introduced mutation Y116D to the MHC thus changing the HLA type from B*44:05 to B*44:02; see Figures 1 and 2. The workflow of the molecular dynamics simulation of the penta-L-alanine system is closely related to that in the work of Bernhard and Noé [ 18].

The plasmid pIM26 encoding E194GAGmut was engineered using pIM32 as template and introducing mutations in the E194 gene with the QuickChange II site-directed mutagenesis kit (Stratagene) and oligonucleotides 5′-GGTTAACTGGGAGGCGATAGGAGCGACTGCGGCCCCTCTTAATGCAGCTGTTGCAAACGGTGACTTATGG -3′ and 5′-CCATAAGTCACCGTTTGCAACAGCTGCATTAAGAGGGGCCGCAGTCGCTCCTATCGCCTCCCAGTTAACC -3′.

A short primer was designed to bind at the 3' end of the template oligo and introduced the 3' seat (5'-CGCG AAGCTTCCAAAAAA-3').

This paper offers a brief introduction to the spherical template indenter and introduces the FTC-time analogy method for forecasting long-term strength of frozen soil.

Obvious candidates include the amplification of non-targeted genomic sequences (for example laboratory contamination), DNA damage or heteroplasmy in the original template, and errors introduced into the DNA during the initial PCR stage (where a non-proof reading polymerase was used).

Hexagonal Ag/Pt nanoshells were prepared by using a hexagonal Ag nanoplate as the displacement template and by introducing Pt ions.

Repair templates can be engineered, however, and introduced into cells to make a defined genomic modification via HR (GT).

If just the right amounts of nuclease and template are introduced into a cell, this 'off-targeting' can be reduced which is important for ensuring gene therapy is safe.

The human NRP1ΔSEA construct was generated by PCR using NRP1WT as a template and primers that introduced a NotI or BamHI restriction site were inserted into the pcDNA 3.1 TOPO expression vector.

Best practices rely on an external authority, not on the community itself, to identify and introduce a superior template.