Sentence examples for template and forward from inspiring English sources

The 1.7 kb fragment of HpDnaG was amplified using H. pylori genomic DNA (ORF Hp0012) as template and forward (5'-ACGGTCGACATGATTCTTAAAAGTTCCATTG-3') and reverse (5'-ACGGTCGACATATGGCGACTAATTCTCCTTG -3') primers having SalI restriction site and Taq DNA polymerase (5PRIME PCR Extender system, 5PRIME gmbH, Hamburg Germany).

Real-time PCR was performed by using the Rotor Gene Q system (Qiagen, Hilden, Germany) and a reaction mixture that consisted of SYBR Green 2 × PCR Master Mix, cDNA template, and forward and reverse primers.

Finally, the 81 or 60 aa of predicted luminal domain of AtGCSI, aa 70 to aa 150 or aa 91 to 150, were subcloned between XYLT35 and GFP using PCR reaction with AtGCSI cDNA as template and forward primer FGCS80 or FGCS60 (see table 2 for primer details) and reverse primer R150 (see above) with respectively KpnI or BamHI site (underlined) to sub-clone into pBLTI121.

Haplogroup distribution in all patients and controls is reported in table 1. > -wrap-foot> PCR exon amplification of NDUFC2 was performed using DNA samples as templates and forward and reverse primers encompassing the sequence of each exon (supplementary table S3, Supplementary Material online).

The spike-in DNA was generated by PCR using wild-type genomic DNA preparation as template DNA and forward ('STG246': cttgcgatttttgcttctcc; complementary to the yyaD locus) and reverse primers ('STH602': ttatcgtgcgaaagcagttg; complementary to the gidA locus) producing a DNA fragment of 7238 bp in size covering the parS-359 site within the parB gene.

For generation of the construct encoding tagRFP-CINCCKVL, tagRFP was amplified by PCR using pTagRFP-C as template and oligonucleotides, forward 5'- CCGCTandGCTACCGGTCGCCACCATGG-3' and reverse, 5'- CCGGATCCCTAGAGGACCTTGCAACAGTTGATACAATTAA GTTTGTGCCGGATCCCTAGAGGACCTTGCAACAGTTGATACAATTAA

The construct encoding GFP plus the last 22 amino acids of RhoB was generated by amplifying GFP with a BssHII site at its 3' end, using pEGFP-C1 as a template and primers, forward 5'-GAGTAGAAGCTTATGGTGAGCAAGGGCGAGGAG-3', and reverse 5'-CATCTTGCGCGCGTCTTGTACAGCTCGTCC-3'.

Blackcurrant cDNA inserts were amplified by PCR using plasmid DNA template and M13 forward and reverse primers that span the multiple cloning site of the vector.

The human IDO gene (NM_002164; a generous gift from Dr. JM Carlin of Miami University) was generated by PCR using a full-length cDNA encoding the gene as template and the forward primer (5'-GGGGACAAGTTTGTACAAAAAAGCAGGCT TCandATGGCACACGCTATGGAAAACTCCTGG-3') and reverse primer (5'-GGG GACCACTTTGTACAAGAAAGCTGGGTCCTAACCTTCCTTCAAAAGGGATTTCTC-3').

The standard reaction volume was 20  μl and contained 1 × SYBR Green PCR Master Mix ABII), 2.0  μl of cDNA template, and both forward and reverse primers at 10  μ M. The initial PCR denaturation step was performed for 5 min at 95°C, followed by 40 cycles of 60 s at 95°C (melting) and 60 s at 60°C (annealing/elongation).

pat3-k1 gene [GenBank: DQ114421] was amplified by PCR with Desiree (WT) as a template and with forward and reverse primers (5'- ATC GAT GGT ACC CCA TTT AGC TGC CTC TTC TGC TG-3' and 5'- TCT AGA CTC GAG GAA CAG GTA CAG GAG GTT TAT TGA C-3').