Sentence examples for template a total from inspiring English sources
Using the cDNA as template, a total of 49 different PCR amplification reactions were performed, using all possible combinations of the seven forward and seven reverse primers (Table 2) and the TaKaRa ExTaq 2× premix (Shiga, Japan).
PCR was conducted by using 1 µL of cDNA as template in a total volume of 20 µL.
Reactions contained 7.5 µl 2× SYBR MasterMix (Qiagen), primer (100 nM), and template in a total volume of 15 µl.
PCR reaction: 150 nM final concentration of forward and reverse primers, 6 µl of QuantiTect SYBR Green PCR Master Mix (Qiagen, Valencia, CA) and 50 ng of cDNA template in a total of 12 µl.
The PCR reaction consisted of 1x Q-Solution (Qiagen), 1x Buffer (Qiagen), 1 µM Primer 1 (5' GCGACTACGTGGTCTACTCG 3'), 1 µM Primer 2 (5' AGGACCCTCATGGCCTTG 3'), 200 µM dATP, 200 µM dTTP, 200 µM dCTP, 100 µM dITP, 100 µM dGTP, 0.3 units HotStar Taq (Qiagen), and 1 µl of DNA template, in a total volume of 10 µl.
10 ng purified total RNA was used as template for a total of 10 ul reaction.
A sample of 2 ng of total RNA was used as a template in a total volume of 20 µL.
2 μl of each cDNA were used as template in a total volume of 50 μl.
The pair-wise alignment with the template contains a total of 66 gap positions.
cDNA (20 ng) was used as template in a total reaction volume of 10 μl.
The functional images were spatially normalized [Friston et al., 1995a] to a standard MNI-305 template using a total of 1,323 nonlinear-basis functions.
