Sentence examples for temperature polymerase from inspiring English sources

Exact(1)

KRAS: Kirsten rat sarcoma virus homolog 2; EGFR: Epidermal growth factor receptor; COLD-PCR: Co-amplification at lower denaturation temperature polymerase chain reaction; FFPE: Formalin-fixed paraffin-embedded; WT: Wild type; T m : Melting temperature; T c : Critical denaturation temperature; Ct: Cycle Threshold; PNA: Peptide nucleic acid The authors declare that they have no competing interests.

Similar(58)

Defining the influence of sequence and temperature on polymerase extension will enable more rapid and efficient PCR.

The thermodynamic properties of DNA are used for effective local search of optimal solutions using biochemical techniques, such as denaturation temperature gradient polymerase chain reaction and temperature gradient gel electrophoresis.

Real-time PCR reactions were performed on 96-well plates (Life Technologies) at a set time and temperature, including polymerase activation at 50°C for 2 minutes, preliminary denaturation at 94°C for 10 minutes, denaturation at 94°C for 15 s, and annealing of primers, probes, and synthesis at 60°C for 1 min at 40 cycles.

We tried in vain to amplify the segment linking exons 14 and 15 by long-range PCR from genomic DNA using various parameters including different primers, annealing temperatures and polymerases.

Thermal cycler machine was extensively used machine for temperature transfer of polymerase chain reaction (PCR) to amplify DNA sample.

Since spontaneous hydrolysis of the triphosphate group occurs with a fixed rate constant at a constant temperature, a faster polymerase will be able to add more nucleotides to a growing chain between each such hydrolysis event, reducing the aggregate penalty for a given length of nucleic acid.

Forward primer, Ciz1-jex8-ex12F (5'CTCCandGCAGTTACAGGAC3') and reverse primer hCiz1-Jex13-ex14R (5'CTCAAGCGACTTCAGCTCCT3') were PCR amplified at 60°C annealing temperature using Taq polymerase (New England Biolab (NEB).

In S. cerevisiae, cdc17/pol1 mutants, encoding temperature sensitive DNA polymerase α, exhibit very long telomeres, high levels of telomeric ssDNA and elevated recombination at telomeres [50,51].

Therefore, it is not recommended to design PRTs in SINES, although these could potentially be used with careful optimization, e.g. high annealing temperature, hot-start polymerase, short extension time and reduced cycle number.

Earth's diurnal physicochemical gradients that drive chemical evolution echo in the temperature cycling of polymerase chain reactions, in cellular circadian clocks, and more generally in the repeating processes of microbial growth and division.

Show more...

Your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: