Examples of nuclear targeted NPs are also discussed, stressing on the critical aspects of nuclear targeting and pointing out how the disease state might change the normal NP path and how such change could be exploited to increase efficiency of nuclear targeting.
The other is to identify contents of identity in the landscape (i.e. attributes used to define landscape identity) and the complexity of the identity (i.e. dimensions used to define landscape identity) as a way to increase efficiency in more spatially targeted policies.
In addition, multifunctional immunotherapy targeting several antigens from several different tumour types and metastases may be beneficial to increase efficiency.
Firstly, whilst a positive level of correlation between the auxiliary and target variables always led to increased efficiency of the double sampling estimators over that achieved using simple random sampling, there may be more work involved in double sampling than with simple random sampling alone because of the need to obtain the data for the auxiliary variables.
Consistent with this central role in DNA damage response, it was shown that inhibition of Che-1/AATF strongly enhanced the cytotoxicity of anti-cancer drugs, suggesting Che-1 as a possible therapeutic target to increase the efficiency of DNA damaging drugs (Bruno et al. 2006; Halazonetis and Bartek 2006).
Mental health self-efficacy influences symptom outcomes of a self-guided mobile phone and web-based psychotherapeutic intervention and may itself be a worthwhile target to increase the effectiveness and efficiency of online treatment programs.
This allows for an ideal and individualized exercise intensity (i.e., heart rate) and workload to be targeted to increase mitochondrial function and performance efficiency in the forms of increased lactate clearance capacity and capacity to oxidize fat in the muscle, which is key for performance.
To avoid nonspecific targeting and increase efficiency, 4 independent target sequences and 1 nonspecific sequences (NC) were used as follows: #1: CCAGGACCCTGAGAGTTATGT, #2: TCTCTTCCTGAGGGACAAGAT, #3: GAGTTACTACCAGGGCTCTTT, #4: GCAGTTCCTCAGAGAGCTGTT, and NC: GGAATCTCATTCGATGCATAC.
Synergistic TALEs may be useful to significantly increase efficiency but may increase off-target effects at the same time.
Alternative approaches to spatial targeting include targeting specific receptors that are plentiful on the target cell to increase transfection efficiency.
