Sentence examples for targets sequence from inspiring English sources
We show that compounds assembled on-site that recognize structure have the highest potencies amongst small molecules and are similar in potency to a vivo-morpholino modified oligonucleotide that targets sequence.
To accurately evaluate the value and efficiency of the guide RNA-mediated cleavage, we wanted to compare it to another enzymatic activity that targets sequence specific endonucleolytic cleavage in trans.
DrugBank is an open-access database that provides users with information on drugs (chemical, pharmaceutical, and pharmacological data) and their targets (sequence, structure, and metabolic pathway).
The targets sequences were AAGCGACCAGGAUUAUAUUCU and AAGUGAGGUGGAAAGGCGUUU respectively.
To find potential targets sequences to accurately discriminate L. (V).
The target sequence is underlined.
The yellow shadow marks the target sequence recognized by crRNA.
A selected target sequence contained AA leader followed 19-nt.
The target sequence for HER2 was 5′-GGAAGGACATCTTCCACAAGA-3′.
(H) The target sequence at the DNMT3B locus.
(E) The target sequence at the FANCF locus.
