Sentence examples for targets gap from inspiring English sources

Exact(1)

Using these targets, gap analyses should be conducted to identify ecosystem types currently under-represented in the protected area network (or within degraded protected areas that have lost their conservation value) and new areas required for priority species that have insufficient habitat to maintain large viable populations.

Similar(59)

Besides, we noticed that the mRNAs for a couple of axogenesis-related HuD targets, GAP-43 (also known as neuromodulin) and cgp-15 (also known as neuritin; Akten et al., 2011), were not detected in the chip as being up-regulated.

Target, Gap and other retail stores posted poor sales numbers, driving their stocks lower.

Costco, Target, Gap and Macy's all saw same-store sales decline.

In all the experiments, the substrate-target gap was set at 10 cm, magnetron target current was 0.1 A, base pressure was 5 × 10−4 Pa, and work pressure was (4 ± 1) × 10−1 Pa.

In all experiments, substrate-target gap was set at 10 cm, magnetron target current was 0.1 A, base pressure was 5 ⋅ 10− 4 Pa and work pressure was (4 ± 1) 10−1 Pa.

Well... Target, Gap and H&M, to name a few! Check out some of FLOTUS' most affordable looks below and tell us which outfits look, well, cheap and which are chic.

Furthermore, small molecule like PQ1 directly targeting gap junction channel was used to increase GJIC.

Our data indicate that targeting gap junction function using inhibitors, such as 1-octanol and CBX, is associated with attenuated CSC maintenance and tumor progression.

When the central fixation cross disappears before the onset of the peripheral target (gap condition), more errors are produced than when the peripheral target appears while central fixation is still visible (overlap condition).

GAPDH was used as the reference gene and targeted GAP-DH sense (5' CATCCACTGG TGCTGCCAAG 3') and antisense (5' GAGGGAGATGCTCAGTGTTGG 3') primers.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: