Sentence examples for targeting gap from inspiring English sources

Buoyed by its success, Avaaz says it is now targeting Gap and trying to embarrass others into signing.

Furthermore, small molecule like PQ1 directly targeting gap junction channel was used to increase GJIC.

Our data indicate that targeting gap junction function using inhibitors, such as 1-octanol and CBX, is associated with attenuated CSC maintenance and tumor progression.

I also recommend leveraging the strengths of your regional assets, cultivating a strong entrepreneurial culture and focusing efforts around accelerating the growth of high-potential companies by targeting gaps and barriers to growth.

For those PCRs targeting gaps of ~900 bp or greater, the long PCR reaction and thermoprofile was used (see above).

Furthermore, sequencing projects are now targeting "gaps" in genomic diversity, directly via the GEBA project [ 1] and indirectly through various environmental genomic studies [ 2, 3].

The FLcDNA sequences will be essential to the ongoing curation and annotation of the poplar genome, in particular for targeting gaps in the current genome assembly and further improvement of gene predictions.

Finally, she is interested in applying this work to the design of interventions that aim to target gaps in school readiness, including early literacy, math, and self-regulation skills.

Specifically, technology helps us create registries that house patient data associated with chronic conditions, such as elevated blood pressure, to identify and target gaps in care to help improve health outcomes.

GAPDH was used as the reference gene and targeted GAP-DH sense (5' CATCCACTGG TGCTGCCAAG 3') and antisense (5' GAGGGAGATGCTCAGTGTTGG 3') primers.

Future messages should target gaps in knowledge about serodiscordance, provide logistical information about CVCT services, and aim to reduce stigma and fear.