Sentence examples for targeting event from inspiring English sources

Exact(42)

Not all import involves an initial targeting event.

We identified one successful targeting event among ∼1000 lines screened.

200 ng of genomic DNA was amplified using oligonucleotides designed to identify the 5' targeting event (HPRT5'FLKfor - GGTAGTAACAAGTGGTGGAC and HPRT3662R – CCACTTTCGCTGATGACAC) and 3' targeting event (MC1tkfor – GGGGAATGGTTTATGGTTCG and HPRT3'FLKrev – CAAATGCAGGGAACGACACC).

Two separate ES cell clones, designated G1 and H11, gave rise to separate mouse lines that transmitted the targeting event at the Cypor locus.

For almost all TA proteins, regardless of their organelle destination, the initial targeting event is mediated by cis-acting sequences within the C-terminal region of the protein [2].

As a final point, the SmnC-T-Neo and Smn2B-Neo lines were specifically designed to be progenitor alleles, so that potentially three useful lines of mice could be generated from each targeting event.

Show more...

Similar(18)

Shin, H. Y. et al. CRISPR/Cas9 targeting events cause complex deletions and insertions at 17 sites in the mouse genome.

The Finland-based hardware startup isn't just targeting events with large audiences, such as tech conferences.

CRISPR/Cas9 targeting events cause complex deletions and insertions at 17 sites in the mouse genome.

PCRs with primers designed to amplify precise targeting events were used to confirm specific targeting events.

Gene targeting events were identified by PCR (Figs. 3A & B).

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: