Sentence examples for targeting event from inspiring English sources

Not all import involves an initial targeting event.

We identified one successful targeting event among ∼1000 lines screened.

200 ng of genomic DNA was amplified using oligonucleotides designed to identify the 5' targeting event (HPRT5'FLKfor - GGTAGTAACAAGTGGTGGAC and HPRT3662R – CCACTTTCGCTGATGACAC) and 3' targeting event (MC1tkfor – GGGGAATGGTTTATGGTTCG and HPRT3'FLKrev – CAAATGCAGGGAACGACACC).

Two separate ES cell clones, designated G1 and H11, gave rise to separate mouse lines that transmitted the targeting event at the Cypor locus.

For almost all TA proteins, regardless of their organelle destination, the initial targeting event is mediated by cis-acting sequences within the C-terminal region of the protein [2].

As a final point, the SmnC-T-Neo and Smn2B-Neo lines were specifically designed to be progenitor alleles, so that potentially three useful lines of mice could be generated from each targeting event.

Shin, H. Y. et al. CRISPR/Cas9 targeting events cause complex deletions and insertions at 17 sites in the mouse genome.

The Finland-based hardware startup isn't just targeting events with large audiences, such as tech conferences.

CRISPR/Cas9 targeting events cause complex deletions and insertions at 17 sites in the mouse genome.

PCRs with primers designed to amplify precise targeting events were used to confirm specific targeting events.

Gene targeting events were identified by PCR (Figs. 3A & B).