Sentence examples for targeted for integration from inspiring English sources

The linearized recombinant pZJM-OD plasmid was targeted for integration by homologous recombination into the transcriptionally silent ribosomal RNA gene repeat spacer of the T. brucei genome.

This plasmid was then targeted for integration at the BEM1 locus by cutting at the unique PstI site in BEM1.

A sub-group of patients routinely consult at the ER, and this group should be targeted for integration within the PHC system.

PDV DNA enters the nucleus of infected cells wherein viral gene products may down-regulate larval immune response genes and could potentially be targeted for integration by actively transposing host Helitrons.

A gene of interest is targeted for integration into the pDEP vectors by the addition of specific homologous sequences, which are designed into the oligos for the gene of interest, by PCR amplification.

The resulting plasmid was targeted for integration at the URA3 locus by cutting at the unique EcoRV site.> To generate Bem1-GFP-CAAX, a sequence (AAGAAAAGTAAGAAATGTGCCATCCTGTAA) encoding the polybasic-prenyl motif was introduced before the stop codon of GFP on an integrating BEM1-GFP plasmid.

Complete mm-Wave integration is targeted for the 60-GHz transmitter front-end aiming toward more flexible and robust heterodyne architecture in terms of overall gain, output power, and total power consumption.

Their DNA does not normally integrate into a preexisting DNA; it may perhaps have been a target for integration of retroviral DNA.

But the travel category in particular seems the most logical target for integration, analysts said.

It could be Witherow, but he can't do it from his Sunday redoubt, because the Sunday Times, in strict cash terms, is the ripest target for integration savings.

Indeed, another BACH2 intron is a target for integration by murine leukemia viruses found in B cell lymphomas of mice (32).