Sentence examples for targeted at correcting from inspiring English sources

Exact(2)

These new medications, targeted at correcting endothelial dysfunction, have led to a substantial increase in life expectancy.

The past two decades have seen most research efforts targeted at correcting the ion transport deficiency of cystic fibrosis (CF), highlighting the required promotion and development of new drugs to tackle CF (Becq et al., 2011, Boyle and De Boeck, 2013, Riordan, 2008).

Similar(58)

Also, since the pattern of IAP upregulation varies between tumour samples, any IAP-based therapy is going to need to be targeted at the correct IAP – and in some cases multiple IAPs – in a patient-specific manner.

"Corrective" behaviour targeted at LGBT people is common, say rights groups, with even rape used against lesbians, while families may send a gay son to the monastery to "correct" his sexual orientation.

You would think so, given the rumours about a negative advertising campaign targeted at Eastern Europe, and one minister's call for the need to "correct the impression that the streets here are paved with gold".

It's targeted at one species.

Cost of sales is targeted at 40%.

Treatment is directed at correcting the abnormality.

To detect the correct targeting at the 3' end of ROSA26, we amplified ∼6 kb genomic DNA fragment using primers Rosa8 (GGATCCCCGAATTCTAGATAACTGATCATAATCAGCC) and Rosa9 (GGGGAAAATTTTTAATATAAC), and LA Taq with LA PCR Buffer II (Takara, Cat No. RR002M).

To detect correct targeting at the 5' end of ROSA26, we amplified ∼1.5 kb genomic DNA fragment using primers: Rosa3 (CCACTGACCGCACGGGGATTC) and Rosa4 (TCAATGGGCGGGGGTCGTT), and LA Taq with GC buffer I (Takara, Cat No. RR02AG).

Successful deletion and correct targeting at both sites was demonstrated by Southern blot analysis after digestion of tail DNA with EcoR I and hybridization with the 3'probe which resulted in bands at 7.4 kB (wild-type allele) and 3.6 kB (Neo-deleted allele) or by BamH I digest and hybridization with the 5'probe resulting in bands at 6.5 kB (wild-type) and 4.8 kB (targeted allele).

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: