Sentence examples for tandem between from inspiring English sources

Mr. Putin's return has cast the so-called tandem between the two men into doubt.

Power couples could switch, in tandem, between government and the private sector, one spouse bringing in money while the other climbed the rungs of government, sharing intelligence along the way.

There are 0 to 4 copies of a 24 bp sequence (5' CAGTGTCGGCTCGCCGAACTTGAG) repeated in tandem between these (Fig. 5A).

Differential coexpression analysis identified numerous modules of metabolites whose correlation patterns changed in tandem between AL and DR conditions.

These three modules occur in tandem between amino acid sites 625 709 in human SP1 and are highly conserved across vertebrates.

We have established collaboration between two institutions with the hope of improving prostate cancer treatment in Ghana and plan to develop clinical trials that can be conducted in tandem between our two institutions.

The rISTs showed more than 99% identity with each other and were always organized in direct tandems between each copy of Hosim1.

DPO was designed by a novel method of tandem cyclization between ethyl glyoxalate and amines, the series of DPO derivatives were synthesized by change of the amines.

The activation of RAF has been shown to occur either through an activating point mutation (BRAF V600E), or much more frequently, through genomic alteration on 7q34 which creates a tandem duplication between the KIAA1549 gene and the BRAF gene kinase domain [10,11].

As compared with bare Pd@MIL-100(Fe), bimetallic PdAu@MIL-100(Fe) showed superior activities for the tandem reactions between amines and alcohols to produce N-alkyl amines under visible-light irradiation, ascribed to the promoting effect of metallic Au in the photocatalytic alcohol-to-aldehyde dehydrogenation.

The copy numbers of the tandem repeat between the two TRDs also varied from 0 to 4 (Fig. 5D).