Sentence examples for take sequence from inspiring English sources

Neither the scoring models nor the existing data mining methods adequately take sequence information in credit card data into account.

Remove Ronchi ruling and take sequence of uniform images.

Therefore the best way to move forward is to take sequence data off center stage and supplement it with these other data sources.

The answer to this lies in a closer inspection of the repeated consensus sequences in table 1. Let's take sequence TAAGACCTATGTTAGTAAAG for chromosome 6 which has a double cytosine.

However, the nearest-neighbor approach might be substantially biased toward one end in the phylogeny and does not take sequence conservation into account, whereas the multiple-alignment approach usually does not consider the exact phylogenetic position of the target species and a careful selection of the seed sequences is an additional parameter.

We used miRNA targets that were computed based on genome-wide prediction algorithms that take sequence complementarity into account.

To analyze the effects of pooling, we extended our model of phenotype sequencing to take sequencing error into account.

R8S uniquely does not take sequences as input, but instead takes branch lengths and tree topology.

The IsPath function takes sequence of blocks and edges as an input and checks if the sequence forms a path in the edge relation.

He is known as a serial photographer, taking sequences of pictures of people in the same profession (artists of the 1950's, art critics, architects).

The methodology of the study has involved taking sequences of 100 consecutive scans at three distinct scenes along the route of a mining haul truck operating in a typical surface mining environment.