Sentence examples for tag consisting of from inspiring English sources

The expression cassettes of the most successful vectors are based on a tandem affinity purification tag consisting of an octahistidine tag followed by the myosin motor domain tag.

Here we report that the insertion of a short peptide tag, consisting of Ser-Lys-Ile-Lys (SKIK), adjacent to the start codon of genes encoding difficult-to-express proteins can increase protein expression in Escherichia coli and Saccharomyces cerevisiae.

An Escherichia coli expression vector for intracellular T7 promoter (PT7) driven production was constructed with an N-terminal dual affinity tag, consisting of a hexahistidyl (His6) tag in frame with the ZSPA-1 tag, thus allowing alternative affinity recovery methods.

The mle gene from O. oeni 20255 was amplified from genomic DNA using primers GATGATCTCGAG AAAAGACATCATCATCATCATCAT GGTGGAGACTACAAGGATGACGATGACAAG ATGACAGATCCAGTAAGTATTTTA and GAGCTCGAATTC TTAGTATTTCGGATCCCAC to introduce a N-terminal tag consisting of an His6-tag (bold) and the enteropeptidase (enterokinase, EC 3.4.21.9) restriction site (italic).

Here, a "tag" consisting of a specific amino acid sequence, often a series of histidine residues (a "His-tag"), is attached to one terminus of the protein.

This library consists of 5,854 yeast strains each expressing a unique yeast ORF fused to a tripartite tag consisting of His6, an HA epitope, a protease 3C cleavage site, and the IgG-binding domain (ZZ) from protein A, under the control of the GAL1 promoter for inducible expression.

The RFID tag consists of an antenna and a microchip.

The reader query to tag consists of, among other things, the frame size or number of slots for which the reader will listen for tag responses.

The signal of a tag consists of a preamble (6 bits), a postpreamble (8 bits) and an RN16 (16 bit), and each bit is encoded with FM0.

An RFID tag consists of an antenna that is connected to an electronic circuit, which in most cases is built on an integrated circuit.

As the minimal myc epitope tag consists of only 10 amino acids, we reasoned that it might not interfere with the geometry and proper folding of PrPC, and with its function.